PREHISTORIC LIFE HOME PREHISTORIC LIFE TABLE OF CONTENTS OBL HOME OBL REFERENCES
THE ORIGIN OF LIFE
OCEAN

THE ORIGIN OF LIFE

      How did life start?  Could life develop through natural processes from the molecules of a nonliving world? The idea that a living thing could arise from nonliving things is not only a very old idea, it was the predominant idea held in Western civilization prior to the mid-17th century.  It was commonly thought that flies would arise spontaneously from decaying garbage, mice would appear from wet sawdust, frogs would spring directly from mud, etc. 

…insects such as lice, fleas, and bugs.  All these as a result of copulation generate what are called nits, and from these nothing further is produced.  The slightest quantity of putrefying matter gives rise to fleas…

Aristotle, Historia Animalium IV, p. 209

 

In so far as our powers of observation and our human intelligence can understand nature, we have no evidence that any flesh with life and sensation is born unless it is from one of four sources: either from water and earth, which serve as material elements, or from the shoots or the fruits of trees, or from the flesh of animals (as happens in the case of countless kinds of worms and reptiles), or from the copulation of parents.

--Saint Augustine, The Literal Meaning of Genesis, Vol. 2., Book 9, Section 29

 

Here questions are raised also about the mice and door mice, whence they originate and how.  Indeed, we have learned from experience that not even ships which are continually floating on the sea are safe from mice.  Likewise, no house can be so thoroughly cleaned that no mice are produced in it.  We can also inquire about the manner in which flies come into existence.  Likewise, where the birds go in the fall….Thus mice belong to the kind produced by their unlike, because mice originate not from mice alone but also from decay, which is used up gradually and gradually turns into a mouse….

Martin Luther, Commentaries on Genesis, Vol. 1, p. 52

 

After Louis Pasteur demonstrated that living things, even microscopic living things, arose directly from prior living things, the question of the origin of the first living things became much more important.

    It is not known how life originated--there are no time machines and fossils of pre-cells either do not exist or are difficult to interpret.  Even if life is generated someday in a lab through a series of chemical reactions, there would be no proof that the first living things evolved through the same sequence of chemical reactions.  As a result, science will never be able to prove how life started.  Scientists can, however, study what scenarios are possible given the conditions of the early earth and determine if the characteristics of modern cells offer support for any of the models.  The question boils down to this: over the course of a few hundred million years, could the sum of all the chemical reactions which occurred on the early earth (in its oceans, its continually flooded tidal zones, its subsurface, its volcanic vents, and even in the material which was bombarding it from space) produce complex aggregates of molecules which achieve the level of complexity of the most minimal forms of life?  Obviously, answering this question is complicated by the facts that scientists are just beginning to appreciate the wide array of organic molecules which can be produced in the absence of life, the conditions of the early earth, the contribution to the chemistry of the early earth made by molecules found in comets and meteors, etc.  Although it is easy enough to study the simplest cells alive today, these cells are more than 3.5 billion years removed from the first cells and they should not be considered as models for the simplest living things.

     Is it possible that life developed through natural processes on a lifeless earth?  Charles Darwin suggested that life could have arisen chemically “in some warm little pond, with all sorts of ammonia and phosphoric salts, light, heat, electricity, etc. present.” (He never made this suggestion publicly, perhaps for fear of the public reaction to it.) There is a great body of accumulating evidence which suggests that many of the important steps in the origin of life could have occurred through natural processes.   Although life has not been generated in a laboratory, it is unrealistic to expect that biochemists succeed in replicating all of the chemical reactions which could have occurred on an entire planet (and the surrounding solar system, given that extraterrestrial bombardment was adding organic content to earth) over a period of hundreds of millions of years, especially since this question has only be subject to experimental investigation for fifty years or so.  The discoveries which have already resulted from this research (such as the catalytic properties of RNA) have already made great contributions to molecular biology and organic chemistry.

     Although science can not at present answer the question of whether life evolved (and may never be able to do so), there are simpler questions which can be asked and possibly answered.

 

1)     Is it possible that organic molecules (those complex molecules of living things) arose from simple inorganic molecules in the absence of life?  Yes.

 

 

     Organic molecules were once thought to exist only in living things and to have possess an “animism” or “vitalism” which could not arise without life (Joyce, 1998).  Vitalists once argued that organic molecules could never be generated in a lab or, for that matter, anywhere outside a living organism.  They were proven wrong.  Organic molecules can be formed without life in labs and organic molecules have been detected in meteorites, comets, and several bodies of our solar system (such as the Jupiter moons Callisto and Ganymede).   In other words, the organic molecules which are the “the stuff of life” can be found without life.

      The Miller-Urey experiment (and subsequent experiments) demonstrated that all the simple organic molecules which life depends on can be synthesized using only the gases of the primitive earth's atmosphere and a source of energy.  There would have been plenty of energy in a primitive earth—the heat of a semimolten planet, lightning, solar radiation unfiltered by an ozone layer, etc.  By simply mixing inorganic molecules and energy, the following organic molecules have been produced: all the amino acids found in living things (in addition to amino acids not found in living things), all essential sugars, triphosphate nucleotide precursors needed for the synthesis of the DNA and RNA, aldehydes, carboxylic acids, and others.   These organic molecules synthesized in the absence of life could incorporate a large percentage of the available carbon.  Miller found that up to 10% of all carbon atoms could be incorporated into organic molecules and up to 2% incorporated into amino acids.  An analysis of a meteorite supported the results of the Miller-Urey experiment: both the meteorite and the experiment produced some of the same amino acids and in the same relative quantities.

2)     Could these small organic building blocks have joined to form larger biomolecules in the absence of life?  Yes.

 

 

 

 

      In living organisms, small organic molecules (monomers) can not only function alone, they can bind to each other to form long chains (polymers).  Can monomers join to form polymers in the absence of life?  Yes.  Not only can this occur in solution, there are a number of catalysts which can speed these reactions.  Certain mineral surfaces (feldspar, calcite, zeolites, clays) provide sites where small organic molecules can fuse to form larger ones.  The small molecules (RNA nucleotides, amino acids) absorb onto these surfaces and, since they are in close enough proximity to each other and in the right orientation, they can bond to form chains.  Small proteins of over 200 amino acids have been produced and short strands of DNA and RNA (up to 50 nucleotides long).   Because minerals help to catalyze polymerization reactions, the rocks of early earth could have been covered with chains of at least tens of monomer units (Joyce, 1998).

3) Can molecules replicate themselves in the absence of life?  Yes, to some degree.

      Modern organisms depend on a very complex set of mechanisms to replicate their genetic code in order to reproduce.  Can the replication of simple molecules occur in the absence of life?  Yes.  Short RNA and DNA molecules can serve as templates and replicate themselves.  (One RNA has actually shown itself not only to be a template of its own replication, but a catalyst of RNA replication as well.)    In 1996, a small protein (based on a protein found in yeast) was observed to replicate itself.  Amines and esters can combine to form an amide which then serves as a template for other amines and esters to do the same.  There are a number of organic molecules which are not found in living things which have been shown to replicate (especially vinyl homopolymers and copolymers). 

4) Living organisms use certain forms of molecules (stereoisomers) and not others.  Can this nonrandom selection of stereoisomers occur in the absence of life?  Yes.

STEREOISOMER STEREOISOMER

     Living things use one form (or stereoisomer) of amino acids and sugars but not the other.  Are there mechanisms which could produce such a preference?  There is evidence that the form of amino acids found in living things is more likely to form spontaneously, there are clays which facilitate the formation of chains with only one form, and catalytic organic molecules are known which join only similar stereoisomers.

5)     Could organic molecules form membranous balls?  Could these precells perform some activities that cells perform? Yes.

 

     Living cells are surrounded by lipid cell membranes.  Although lipids can form in the absence of life, could such lipids spontaneously form cell membrane-like structures? Yes.  Lipids in solution form layers that are similar in structure and function to those of cell membranes.  In solution, lipids can form spheres known as micelles, coarcervates, and microspheres.  Simulations of the formation of organic molecules in the interstellar ices of comets (using UV light) form organic molecules that self-assemble into such vesicles.  These vesicles can accumulate organic molecules inside themselves, increase in size, and even split once they reach a certain size.  If enzymes (proteins which speed chemical reactions) are in these droplets, chemical reactions can occur.  If they contain the enzyme RNA polymerase, RNA nucleotides are taken from the environment and assembled into RNA chains (Zimmer, 1995).  .  Organic molecules gathered from meteorites have been found to form these membranous balls in water.

 

THE RNA WORLD

6)  Does RNA display the ability to serve as both a genetic code and catalyze reactions?  Yes.

     Modern cells are very complex.  For example, modern cells use proteins to catalyze their chemical reactions but the synthesis of protein depends on RNA and the synthesis of RNA depends on DNA.  Since the synthesis of DNA itself depends on protein, how could the first cells function without three sets of complex molecules, DNA, RNA, and protein?  It is possible that the first cells existed in an “RNA world” in which protein and DNA did not exist.  Could RNA molecules have performed the functions of proteins while simultaneously serving as the first genetic code?  In modern living things, RNA is still the only molecule which functions both as a genotype (a genetic code) and phenotype (determining outward appearance—many RNAs are functional by themselves and are never converted to protein).  There are a number of observations which suggest that RNA was the primary functional molecule in the earliest cells.

a) Nucleotides (primarily RNA nucleotides) have very diverse roles in cells

      An analysis of modern cells suggests that RNA is central to many cellular mechanisms.  RNA nucleotides (the monomers which compose the chains of RNA) are essential molecules for modern cells.  The molecule which cells use for virtually all of their energy transactions (ATP) is an RNA nucleotide with additional phosphate groups added.  In other words, the energy which you are using at this moment to power muscle contractions, pump ions, move cilia, cause cells to divide, etc. is being derived from ATP, an RNA nucleotide with additional phosphate groups.   Most “enzyme helpers” or coenzymes are either modified nucleotides or can be synthesized from nucleotides. 

b) RNA molecules can act as enzymes (both those found in living cells and sequences generated in the absence of life)

      Although proteins are indispensable in modern cells (for example, proteins called enzymes catalyze chemical reactions), RNA molecules can be found which perform many of the tasks done by modern proteins.  In collections of random RNA sequences, some RNA molecules can be isolated which perform certain functions (such as catalyzing reactions).  RNA enzymes (ribozymes) have been isolated from these random sequences that help to copy existing RNA molecules using the same reaction that proteins use in modern cells.  These ribozymes can also undergo a “natural selection” of sorts in which researchers favor a certain type of ribozyme and over time these random sequences produced more efficient ribozymes which can catalyze the reaction hundreds to millions of times faster than the rate observed without the ribozyme (Bartel, 1993; Wright, 1997). 

 

c) Ribozymes in modern cells can catalyze a diversity of chemical reactions

     In the early earth, could RNA ribozymes have functioned in the conversion of RNA to DNA, the conversion of RNA to protein, and the splicing of small coding units to form functional genetic messages?  This is not an unreasonable hypothesis, given that RNA molecules in modern cells perform these and other reactions.     RNA continues to perform diverse functions in living cells and is most active in the cellular activities that would have been the most ancient (such as the splicing of the genetic message and the synthesis of proteins). 

     The reactions that modern RNA molecules isolated from living cells perform include the cutting and splicing of RNA molecules (spliceosomes, self-editing introns; Sharp, 1985; Cech, 1987; Kruger, 1982), extending the ends of chromosomes (telomerase) (Poole, 1997), the modification of the tRNAs used in protein construction (Rnase P), nucleotide insertion (Mueller, 1993), breaking triphosphate bonds for energy (srp RNA) (Jeffares, 1998) and the folding, cleavage, nucleotide modification, and assembly of ribosomal subunits (snoRNAs; Maxwell, 1995).  Proteins synthesis, arguably one of the most important cellular processes, occurs at structures known as ribosomes whose RNA actually functions as a ribozyme (Steitz, 2003)

 

d) Ribozymes generated in the lab can catalyze a diversity of chemical reactions

     Can artificial ribozymes replicate themselves?  Yes and no.  Although ribozymes which perform the necessary reactions in self replication have been isolated, they do not function at the levels that a precursor to a living cell would require (Bartel, 2000).  Ribozymes can recognize a primer template and attach complimentary bases to the template.  The ability to join RNA nucleotides to a primer has been accomplished by different ribozymes with different structures and biochemical properties.  The accuracy of the addition of complementary bases was 97% and could be increased to 99% by altering the nucleotide concentrations.  One ribozyme could extend the primer by 14 nucleotides (although the ribozyme itself was 189 nucleotides) (McGuiness, 2003). 

      In experiments without cells, ribozymes can be selected for out of random RNA sequences that catalyze chemical reactions such as nucleotide synthesis, forming carbon-carbon bonds, forming bonds that modern ribosomes must form during protein synthesis, and forming the bonds that modern tRNA synthetases (which are proteins) perform in protein synthesis, cleave phosphodiester bonds,  act as RNA ligase, hydrolyze cyclic phosphates, phosphorylate RNA, transfer phosphate anhydride, perform acyl transfer, form amide bonds, form peptide bonds, form glycosidic bonds, and a number of other reactions (Bartel, 2000; Landweber, 1999, Ekland, 1996; Ekland, 1995. Green 1992, Illangasekare, 1995; Lohse, 1996;  Tarasow, 1997; Bartel, 1993;  Unrau, 1998). 

    How could early precells acquire additional catalytic RNA molecules?  Mutations are a source of diversity in modern organisms and would have generated a diversity of RNAs in the early cells.  In modern organisms, lateral transfer can also occur in which genes can move from one species into another.  DNA can be exchanged between living cells and living cells can take up DNA from their environment.  Viruses occasionally introduce DNA fragments from their previous host into their next host. 

     Early genetic systems would have experienced a very high mutation rate and a very high lateral transfer rate.  As a result, “organisms” as the term is currently understood did not exist since genes could be exchanged regardless of lineage.  It has been proposed that the last universal common ancestor of modern organisms was more of a community of cells rather than a single cell. Lateral gene transfer may have been the primary mechanism of evolution in these earliest cells, rather than descent with modification (Woese, 1998). 

 

     THE TRANSITION TO PROTEINS

      The pre-cells which began to utilize chains of amino acids (proteins) would obviously not have been able to create any specific sequence.  Therefore the first proteins used by these cells could not have required for any vital functions.  Then why proteins?  In modern cells, there are a number of examples known in which RNA molecules interact with proteins to form a complex (such as the ribosome and spliceosome).  The proteins function in stabilizing the three-dimensional shape of the RNA and it is the RNA which actually performs the vital function.  It seems that the original function of proteins in ancestral cells was to stabilize RNA.  As time went on, mechanisms were developed to control the amino acid sequence of proteins.  Proteins have the advantage of being able to form more stable 3-dimensional shapes than RNA molecules can.  Over time, proteins replaced most of the functions performed by ancestral RNA molecules and became the primary determinants of the phenotype of cells.  However, proteins did not completely replace RNA.  RNA molecules continue to perform functions in living cells such as the synthesis of proteins and the splicing of genetic messages.  Although cells could conceivably use only proteins for these tasks, catalytic RNAs display what may be a conserved function from the RNA world.

 

THE RIBOSOME

     The formation of proteins from individual amino acids occurs at ribosomes which are made of rRNA (ribosomal) and protein.  Ribosomes must be assembled from several subunits.  In a rapidly growing bacterium, ribosomes may compose 1/4 the weight of the cell.  The RNA molecules which compose the ribosome are drawn in the following images.

rRNA rRNA
     In the following drawing of a ribosome, the RNA is depicted in blue and the small proteins which stabilize the shape of the RNA are depicted in other colors.  Note the percentage of the ribosome which is composed of RNA.  
ribosome
7) Do all living things use essentially the same genetic code? Yes.  Would this have to be true if all living things did not evolve from a common ancestor?  No.
DNA

     The DNA genetic code is practically universal among living things; it must have been present in the last common ancestor of all modern living things (LUCA).  In the genetic code, triplets of DNA bases code for the amino acids of proteins.  If this can be compared to three letter words in a language, all living things speak the same language: the same triplet of bases will code for the same amino acid in every organism on the planet.  With only minor exceptions, a certain DNA sequence (gene) would be read the same way and produce the same amino acid sequence (protein) in every organism on the planet.

      In other words, if the following genetic message was copied from DNA and sent to the cell to make protein: GGUGAUAAGAGGCGGUCGCCGCUG, all living things would insert the same amino acids in the same order (aspartic acid, glycine, arginine, lysine, arginine, serine, proline, and leucine).  Just as it is not necessary that all languages on earth use the same words, it is not necessary that all living things use “CUG” to code for leucine (as opposed to another of the 20 amino acids).  The fact that a certain gene sequence would result in the exact same protein in organisms as diverse as humans, oak trees, and algae (with only minor variations possible in bacteria) indicate that all living organisms have descended from a common ancestor using this genetic code.

 

 

LUCA—THE LAST UNIVERSAL COMMON ANCESTOR

     There are three kinds of cell on earth today (the eubacteria, archaea, and eukaryotes).  By analyzing the molecular mechanisms that these three types of cell have in common, it is possible to make predictions of what the last universal common ancestor of all cells alive today (LUCA) might have been like.  Although all modern organisms have the same requirements of DNA replication, transcription, and translation, there are some differences in these processes between the major groups of living organisms today.  This suggests that LUCA’s replication, transcription, and translation mechanisms were not complete at the time when the three domains of living organisms diverged.  RNA synthesis was present in LUCA but it was less advanced than protein synthesis (Olsen, 1997).  Fundamental differences do exist between the three domains (in the use of fMet only in bacteria, for example).  This suggests that translation was not fixed in LUCA at the time of the divergence of the three major domains (DiGiulio, 2001).  The genetic code seems established just prior to LUCA (Xue, 2003).   There is disagreement over whether the first cells were likely to have existed at hot temperatures or moderate temperatures. 

 

CHROMOSOME SHAPE

mitosis chromosome
     What was the shape of the original chromosomes?  Prokaryotes  (bacterial cells) possess circular chromosomes while eukaryotes (complex cells) possess linear chromosomes.

    Many feel that the compact, circular chromosome of modern bacteria is a modification from the ancestral condition of mini-chromosomes which has been selected for efficiency in rapidly dividing cells.  Multiple copies of mini-chromosomes would have offered protection from mutation and would have facilitated lateral transfer, gene duplication, and gene diversification following duplication.  Before eukaryotes evolved a mitotic cycle which could control the partitioning of these chromosomes into daughter cells, mini-chromosomes would have been distributed randomly when the cell divided (Woese, 1998).

 

INTRONS AND EXONS

What did the original genes look like?  Most prokaryotic genes are continuous coding units while most eukaryotic genes are divided structures, split into segments known as exons which include the coding sequences for proteins and intervening sequences known as introns.

introns

 

&

INTRONS AND THE RNA WORLD

      In the process of converting a DNA message into protein, the DNA is copied into RNA.  The introns of the RNA must be removed and the exons joined before RNA can leave the nucleus and be translated into protein.  How are introns removed?  There are two general mechanisms: some require a complex known as a spliceosome and others remove themselves.  Those that remove themselves show a catalytic activity which is expected of RNAs whose function preceded the transition to proteins.  The spliceosome itself is composed of catalytic RNAs, known as snRNAs.  There is another class of RNA, snoRNA, which is essential for processing the RNA found in ribosomes (Mishra, 1997).  Perhaps the most interesting aspect of the snoRNAs is that most of them are not encoded by their own genes but are rather encoded by the introns of other genes.  Could it be that the oldest introns were actually functional RNA molecules? (Maxwell, 1995; Poole, 1998; OMIM).

     

EXON SHUFFLING

     Since genes come in pieces, a cell can shuffle these pieces to produce a diversity of different proteins.

     In the original cells, large RNA molecules (whether RNAs which functioned on their own or RNAs coding for proteins) could have been assembled by smaller units which were spliced together.

PROTEIN DOMAINS

     Many of the essential portions of proteins form a specific protein fold (domain) and it is this part of the protein that binds the DNA, or binds ATP, or forms the active site of the enzyme, or whatever.   For example, the zinc finger fold binds DNA and is a requirement for all the zinc finger transcription factors, allowing them to bind DNA.  The original zinc finger proteins have been duplicated hundreds of times to produce a superfamily of proteins which bind DNA.  Variations between different members of the superfamily allow them to bind to specific regions of DNA while retaining the zinc finger protein fold as the essential part of the protein. 

     How many protein folds (domains) are there?  Not as many as one might think.  These folds may be central elements of different proteins—the average fold is known to be incorporated into over 100 different proteins but some (such as the TIM barrel, the immunoglobulin fold, the Rossman fold, the ferrodoxin fold, and the helix-turn-helix bundle) are incorporated into thousands of different proteins each.  The twenty five most abundant folds are parts of 61% of proteins with structural homologues throughout all groups of life (Gerstein, 1997).  Although each major group of organisms have different distributions of these folds (for example, immunoglobulins for intercellular communication and zinc fingers for gene regulation are among the ten most abundant folds in animals but not in plants or eubacteria), there are many folds which are shared (Gerstein, 1997).   There are only a few thousand protein domains known in living organisms.  Only 7% are unique to vertebrates (Liu, 2001; International Human Genome Sequencing Consortium, 2001)..